View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17705_low_26 (Length: 226)
Name: NF17705_low_26
Description: NF17705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17705_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 46288796 - 46288874
Alignment:
| Q |
1 |
aaaaatacaaattgggtattctccatcaaacatttctcgttagttatatttttcacttgtttgtctctattgctcttac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46288796 |
aaaaatacaaattgggtattctccatcaaacatttctcgttagttatatttttcactagtttgtctctattgctcttac |
46288874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 145 - 226
Target Start/End: Original strand, 46288940 - 46289020
Alignment:
| Q |
145 |
ctcaaagaagatgaaagctcttatatgacatatgaaaaattcaactttattcaaacaaggaagatctaaagggtatcgtatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
46288940 |
ctcaaagaagatgaaagctcttatatgacatatgaaaaattcaattttattcaaacaaggaagatc-aaaaggtatcgtatt |
46289020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University