View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17705_low_27 (Length: 225)
Name: NF17705_low_27
Description: NF17705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17705_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 16292564 - 16292762
Alignment:
| Q |
7 |
agcaaaggcataaattatgctcaaatttgaagggtcattagttgaacatagaatgctaagattttgtatcactttgatgagttctattttgctaatgttt |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16292564 |
agcaaagacataaattatgctcaaatttgaagggtcattagttgaacatagaatgctaagattttgtatcactttgatgagttctattttgctaatgttt |
16292663 |
T |
 |
| Q |
107 |
atgttgtatttgagttgtatatcgtgatgatatatagtaagttgtttttggtcaaattagaaagtattttggagtttaaggtgaatgtatgtgtccaagc |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16292664 |
atgttgtctttgagttgtatatcgtgatg----atagtaagttgtttttggtcaaattaaaaggtattttggagtttaaggtgaatgtatgtgtccaagc |
16292759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 125
Target Start/End: Complemental strand, 38395482 - 38395372
Alignment:
| Q |
21 |
ttatgctcaaatttgaagggtcattagttgaacatagaatgctaagattttgtatca------ctttgatgagttctattttgctaatgtttatgttgta |
114 |
Q |
| |
|
|||||||||| |||||| || |||||||||| |||||||| |||||||||| | | |||||| | || |||||||||||| ||||||||||| |
|
|
| T |
38395482 |
ttatgctcaactttgaatgggttttagttgaacttagaatgccaagattttgtgttagtgttactttgacggattttattttgctaatttttatgttgta |
38395383 |
T |
 |
| Q |
115 |
tttgagttgta |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
38395382 |
tttgagttgta |
38395372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University