View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17705_low_28 (Length: 223)

Name: NF17705_low_28
Description: NF17705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17705_low_28
NF17705_low_28
[»] chr4 (1 HSPs)
chr4 (23-206)||(30525900-30526083)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 23 - 206
Target Start/End: Complemental strand, 30526083 - 30525900
Alignment:
23 ggaataattaataaatatctcaaaggccaccttgataattcattcaccttaattgaaaaggaaaaagaaatagatgctactagtgcaatggtggattgct 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30526083 ggaataattaataaatatctcaaaggccaccttgataattcattcaccttaattgaaaaggaaaaagaaatagatgctactagtgcaatggtggattgct 30525984  T
123 ttagttttgcttttcatggctaagaaatagaagatcctcttaatattagggttacatggcaatatcatattggttgatttaggt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30525983 ttagttttgcttttcatggctaagaaatagaagatcctcttaatattagggttacatggcaatatcatattggttgatttaggt 30525900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University