View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17706_low_5 (Length: 357)
Name: NF17706_low_5
Description: NF17706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17706_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 148 - 343
Target Start/End: Complemental strand, 20701499 - 20701304
Alignment:
| Q |
148 |
gtattgtccataccaactaagttaagcttatgatccttaaatattgcaaaagtgttcgaatacggtgcgatcttgcaaaagttacgagctagaaagtgta |
247 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||| ||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20701499 |
gtattgtccataccaactgagttaagcatatgattcttaactattgcaaaagtgttagaatagggtgcgatcttgcaaaagttactagctagaaagtgta |
20701400 |
T |
|
| Q |
248 |
actattgcaaaatcattctggttcactgtgattctgacatatatttaaaattgaaagacatgaaaaattctacaattgcaacctaaaacttgaaat |
343 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20701399 |
actattgcaaaatcatactggttcaccgtgattctaacatatatttaaaattgaaagacatgaaaaattctacaattgcaacctaaaacttgaaat |
20701304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 13 - 103
Target Start/End: Complemental strand, 20701637 - 20701547
Alignment:
| Q |
13 |
aatattaaaattgcatcccaataaaactaattactaaatataaacacaatatttagcagcaggattaacatagttgtttgtgattttagtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20701637 |
aatattaaaattgcatcccaataaaactaattactaaatataaacacaatatttagcagcaggattaacatagttgtttgtgattttagtg |
20701547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University