View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17706_low_9 (Length: 227)
Name: NF17706_low_9
Description: NF17706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17706_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 29606498 - 29606302
Alignment:
| Q |
15 |
caaaggagcagatgttggagttgtagtttttggaactattggtttcacaggtgcagctgttggagttgtaactttgggaaccagtggtttagccggtgca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606498 |
caaaggagcagatgttggagttgtagtttttggaactattggtttcacaggtgcagctgttggagttgtaactttgggaaccagtggtttagccggtgca |
29606399 |
T |
|
| Q |
115 |
accgttggagttgcaacctttggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaactggtgacttcacgggagcagatgttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606398 |
accgttggagttgcaacctttggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaactggtgacttcacgggagcagatgttg |
29606302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 136 - 186
Target Start/End: Complemental strand, 29606512 - 29606462
Alignment:
| Q |
136 |
ggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaact |
186 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
29606512 |
ggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaact |
29606462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University