View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17707_low_7 (Length: 251)
Name: NF17707_low_7
Description: NF17707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17707_low_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 44105195 - 44105435
Alignment:
| Q |
11 |
cacagacacgagttaaggaaggtaagaattgaactttcatattgaaatgacaaaattattgattattaacttgaaattgtatacatgatttttaacatcg |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44105195 |
cacagacacgagttaaggaaggtaaaaatcgaactttcatatcgaaatgacaaaattattgattattaacttgaaatagtatacatgatttttaacatcg |
44105294 |
T |
 |
| Q |
111 |
aattgtgtccaatttaatttaaattttattagagtaacaacattatttatcaaaaagtgattgattatctttgcctttggaacaatgacgcaactaatga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105295 |
aattgtgtccaatttaatttaaattttattagagtaaaaacattatttatcaaaaagtgatcgattatctttgcctttggaacaatgacgcaactaatga |
44105394 |
T |
 |
| Q |
211 |
agtaaaataatcgtgaagcgactatgcttgtgaaaactatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105395 |
agtaaaataatcgtgaagcgactatgcttgtgaaaactatt |
44105435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University