View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17708_high_5 (Length: 392)
Name: NF17708_high_5
Description: NF17708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17708_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 63 - 377
Target Start/End: Complemental strand, 8058826 - 8058512
Alignment:
| Q |
63 |
tgtatatttcatgtgtgctatgtttattataggagaccaagatagatacgagtatctgaccaactcatacatggtgcacacagatgatgccactcgtgca |
162 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058826 |
tgtatatttcttatgtgctatgtttattataggagaccaagatagatacaagtatctcaccaactcatacatggtgcacacagatgatgccactcgtgca |
8058727 |
T |
|
| Q |
163 |
cttatatttctttttgagtcagaaaatgttaatggaaggcttatttgttcctcagacagaatatcatttcatcaattgtatgaattgctttgtcaaagat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058726 |
cttatatttctttttgagtcagaaaatgttaatggaaggcttatttgttcctcagacagaatatcatttcatcaattgtatgaattgctttgtcaaagat |
8058627 |
T |
|
| Q |
263 |
atccagggtataacataacaataccaaagtaagtttcataatttataaatctaaccaaacatacattatttagatttgttctaactcacttattttctac |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058626 |
atccagggtataacataacaataccaaagtaagtttcataatttataaatctaaccaaacatacattatttagatttgttctaactcacttattttctac |
8058527 |
T |
|
| Q |
363 |
atatatggttgtttt |
377 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8058526 |
atatatggttgtttt |
8058512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University