View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17708_low_12 (Length: 218)
Name: NF17708_low_12
Description: NF17708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17708_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 32084629 - 32084816
Alignment:
| Q |
10 |
gaagcaaaggaggaacggtggcggggaaagaatcagaagccatggcggaaatgagggtggttttgccggcggatttgtcaccaacaatgacgattctaac |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32084629 |
gaagcaatggaggaacggtggcggggaaagaatcagaagccatggcggaaatgagggtggttttgccggcggatttgtcaccaacaatgacgattctaac |
32084728 |
T |
|
| Q |
110 |
ttccttgagaattgtggtgttgcggttattcgccattggaattggaattgagaaaacgagagaagaagggttttgtgtgattttgatt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32084729 |
ttccttgagaattgtggtgttgcagttattcgccattggaattggaattgagaaaacgagagaagaagggttttgtgtgattttgatt |
32084816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University