View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17708_low_6 (Length: 397)
Name: NF17708_low_6
Description: NF17708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17708_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 14 - 392
Target Start/End: Original strand, 36876869 - 36877248
Alignment:
| Q |
14 |
catatagttcttcccattatcaatcaatctcactctcctgtcttgtttccacttccatgaataaaattggattgatatcataagattcttattatttgct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36876869 |
catatagttcttcccattatcaatcaatctcactctcctgtcttgtttccacttccatgaattaaattggattgatatcataagattcttattatttgct |
36876968 |
T |
|
| Q |
114 |
attataagtggaaacatgatttcaggaacaagcccctcctataacatggactccatgaattgtatcagcaattgaaatgtgaggagagtatcaagatgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36876969 |
attataagtggaaacatgatttcaggaacaagcccctcctataacatggactccatgaattgtatcagcaattgaaatgtgaggagagtatcaagatgag |
36877068 |
T |
|
| Q |
214 |
ggttcaagaactgcctaaccaaattgagcaaggagaacactgaccccaacttgtctccctaattatagaag-nnnnnnnngaaggcattaaaggaacttc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36877069 |
ggttcaagaactgcctaaccaaattgagcaaggagaacactgaccccaacttgtctccctaattatagaagaaaaaaaaagaaggcattaaaggaacttc |
36877168 |
T |
|
| Q |
313 |
aaatctatttataatctattaaatttgaagagcaaattataaagctgccaagtaaatttccaaccctcatttcatatcac |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36877169 |
aaatctatttataatctattaaatttgaagagcaaattataaagctgccaagtaaatttccaaccctcatttcatgtcac |
36877248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University