View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17709_high_10 (Length: 296)
Name: NF17709_high_10
Description: NF17709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17709_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 86 - 285
Target Start/End: Complemental strand, 29850141 - 29849942
Alignment:
| Q |
86 |
gaacctttaaatgattttctatgctatggaaagataaattaaataactttaaattcaagacccttaaataattaattgaagggctatcattgtcttgtat |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29850141 |
gaacctttaaatgattttctatgctatagaaagataaattaaataactttaaattcaagacccttaaataattaattgaagggctatcattgtcttgtat |
29850042 |
T |
 |
| Q |
186 |
tttgcaaccttgttccaatcatcttaagctcaaatttcttgattgatccagcaatgtctctcaatgtagtatccatcacataaggagttttttcacaggt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29850041 |
tttgcaaccttgttccaatcatcttaagctcaaatttcttgattgatccagcaatgtctctcaatgtagtatccatcacataaggagttttttcataggt |
29849942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 198 - 276
Target Start/End: Original strand, 14828372 - 14828450
Alignment:
| Q |
198 |
ttccaatcatcttaagctcaaatttcttgattgatccagcaatgtctctcaatgtagtatccatcacataaggagtttt |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| ||||||||| || ||||||| | ||||||| ||||| |
|
|
| T |
14828372 |
ttccaatcatcttttgctcaaatttcttgatcacaccagcaaggtctctcaaagttgtatccaactcataaggtgtttt |
14828450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University