View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17709_high_11 (Length: 295)
Name: NF17709_high_11
Description: NF17709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17709_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 43055605 - 43055891
Alignment:
| Q |
1 |
tttttaccaaggaagttatatggttatgtgaggattgtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcaga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055605 |
tttttaccgaggaagttatatggttatgtgaggattgtgacgaagaaacaggaccgtgtccaatgactgactctgaaactgatgattcaataacatcaga |
43055704 |
T |
 |
| Q |
101 |
agatgattttaaggcacgacctattcttgatgcaaactggaggtatgaattttgttttgctttatttgaaaatcggcgaacatcta--------tgtata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
43055705 |
agatgattttaaggcacgacctattcttgatgcaaactggaggtatgaattttgttttgctttatttgaaaatcggcgaacatctatatatatgtatata |
43055804 |
T |
 |
| Q |
193 |
tatatcttaatggtgaatatcatgaaagttgaattttctggttaacagtggaaatttgcgctttggtgataatactatcaatggact |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43055805 |
tatatcttaatggtgaatatcatgaaagttgaattttctggttaacagtggaaatttgcggtttggtgataatactatcaatggact |
43055891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University