View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17709_high_2 (Length: 428)
Name: NF17709_high_2
Description: NF17709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17709_high_2 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 247 - 428
Target Start/End: Complemental strand, 5402076 - 5401895
Alignment:
| Q |
247 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5402076 |
tcccctgcatattcattcatgtatatttttcatctaaatacaaaataattatgatgattttatttaggtccatcgattctggatgtgaaacagatgtttt |
5401977 |
T |
 |
| Q |
347 |
gatacgtgtagaaggaacctgttttcgtctccataaggtttgctgattcaccattgatgtcactaattagttatttgttttt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5401976 |
gatacgtgtagaaggaacctgttttcgtctccataaggtttgctgattcaccattgatgtcactaattagttatttgttttt |
5401895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 20 - 112
Target Start/End: Complemental strand, 5402308 - 5402216
Alignment:
| Q |
20 |
tgattcaattcaaaggaattgaaacaggggacacaaatgaagggttggaaccaaattggtatcattgaaaccatttacgaggaagaacgtgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5402308 |
tgattcaattcaaaggaattgaaacaggggacacaaatgaagggttggaaccaaattggtgtcattgaaaccatttacgaggaagaacgtgaa |
5402216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University