View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17709_low_24 (Length: 204)
Name: NF17709_low_24
Description: NF17709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17709_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 11 - 188
Target Start/End: Original strand, 26440768 - 26440945
Alignment:
| Q |
11 |
agagatgaagactgaggaaaaaggtgtatatggccagtttggaagttaaagccaaagaacttgaggtgatcgatattannnnnnnnnattacttctataa |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
26440768 |
agagatcaagactgaggaaaaaggtgtatatggccagtttggaagttaaagccaaagaaattgaggtgatcgatatttatattttttattacttctataa |
26440867 |
T |
|
| Q |
111 |
gaccaatagtatatattaatttgtgattgtattttacaatatatttttatatacaggatgaaatagtttataatcttc |
188 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26440868 |
gatcaatagtatatattaatttgtgattgtattttacaatatatttttatatacaggatgaaatagtttataatcttc |
26440945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University