View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17712_high_22 (Length: 247)

Name: NF17712_high_22
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17712_high_22
NF17712_high_22
[»] chr6 (1 HSPs)
chr6 (1-235)||(1216952-1217186)


Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 1217186 - 1216952
Alignment:
1 cgtcacgagatccaggatgcaacttaacggcatcttcttcaggtgagtttttgagctttaaaacacatgagaatttctctagtgatatacacataagcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1217186 cgtcacgagatccaggatgcaacttaacggcatcttcttcaggtgagtttttgagctttaaaacacatgagaatttctctagtgatatacacataagcag 1217087  T
101 aaaataagataaatggaaaatttgaagttcaaatcttgcatgacttgagatcacatggaattccttttaattataatgcagactgcattttcacatacct 200  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1217086 aaaataagataaatggaaaatttgaagttcaaatcttgcacgacttgagatcacatggaattccttttaattataatgcagactgcattttcacatacct 1216987  T
201 tgcaaaacttcagatcgcaaggattttgttttaat 235  Q
    ||||||||||||||| |||||||||||||||||||    
1216986 tgcaaaacttcagattgcaaggattttgttttaat 1216952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University