View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17712_low_11 (Length: 395)
Name: NF17712_low_11
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17712_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 32171729 - 32172104
Alignment:
| Q |
1 |
aaatgtatagcttgtggtgcagtgttctgaaaggtaaacatgggtgtgggatgattgataatggttccattattgctaaatccacattttcctttattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32171729 |
aaatgtatagcttgtggtgcagtgttctgaaaggtaaacatgggtgtgggatgattgataatggttccattattgctaaacccacattttcctttattga |
32171828 |
T |
 |
| Q |
101 |
agtgattacttcttggtcgtatatcactctttttgaagagtgggctattggtgatgggtgctcggtcaaggcttgtaatgacaagtggttgggagatcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32171829 |
agtgattacttcttggtcgtatatcacactttttgaagagtgggctattggtgatgggtgctcggtcaaggcttgtaatgacaagtggttgggagatcca |
32171928 |
T |
 |
| Q |
201 |
acttgcgtagctgatagcattgagaaaatttatcacggcacgatccattgtaaagtgcctgatttggtttgatattgatggtaattggaaggtgatcact |
300 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32171929 |
acttgcgtagctgataggatagagaaaatttatcacggcacgatccattgtaaagtgcctgatttggtttgatattgatggtaattggaaggtgatcact |
32172028 |
T |
 |
| Q |
301 |
ttgttgaacttgttactgtcggctctggttgagaggctgatattgatggtagtgatgattgtgtggatgttagagc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32172029 |
ttgttgaacttgttactgtcggctctggttgagaggctgatattgatggtagtgatgattgtgtggatgttagagc |
32172104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University