View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17712_low_29 (Length: 239)
Name: NF17712_low_29
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17712_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2127161 - 2127383
Alignment:
| Q |
1 |
ttggatttttctccaccttcttgcatacgaaaacttcacggtcagagtccacgaaggggacccctaggcttgtagtaatagtagaatcttttatatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2127161 |
ttggatttttctccaccttcttgcatacgaaaacttcacggtcagagtccacgaaggggacccctaggcttgtagtaatagtagaatcttttatatccaa |
2127260 |
T |
 |
| Q |
101 |
tatatggcggcagatgatacnnnnnnncattttataattcatcaatacaaacaacaagattttgtaaataaagcaaaataagatttcatattcat--ata |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2127261 |
tatatggcggcagatgatacaaaaaaacattttataattcatcaatacaaataacaagattttgtaaataaagcaaaataagatttcatattcatgaata |
2127360 |
T |
 |
| Q |
199 |
tggggtacgaagagggaggaacg |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2127361 |
tggggtacgaagagggaggaacg |
2127383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University