View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17712_low_31 (Length: 229)
Name: NF17712_low_31
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17712_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 26 - 207
Target Start/End: Complemental strand, 14643010 - 14642829
Alignment:
| Q |
26 |
gagatagcatgaaaataaatcctgaccggtgattggatgaagatcattgaacctatacatatactaaatattttatggccccaatattttgaagacacaa |
125 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
14643010 |
gagatagcatgaaaataaatcctcactcatgattggatgaagatgattgaacctatacatatactaaatattttaaggccgcaatattttgaagacacaa |
14642911 |
T |
 |
| Q |
126 |
ttccatagagctctttgcatcctccgaaggacaaccctgacctcaatcaatcataactaacttttctaaacataagcaaagt |
207 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14642910 |
ctctatagagctctttgcatcctcctaaggacaaccctgacctcaatcaatcataactaacttttctaaacataagcaaagt |
14642829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University