View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17712_low_34 (Length: 222)

Name: NF17712_low_34
Description: NF17712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17712_low_34
NF17712_low_34
[»] chr7 (1 HSPs)
chr7 (6-205)||(23865730-23865928)
[»] chr3 (7 HSPs)
chr3 (106-197)||(23359300-23359392)
chr3 (106-197)||(23364121-23364213)
chr3 (106-197)||(23694599-23694691)
chr3 (106-197)||(23713039-23713131)
chr3 (106-197)||(23731495-23731587)
chr3 (106-197)||(23749950-23750042)
chr3 (15-55)||(47510735-47510775)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 6 - 205
Target Start/End: Complemental strand, 23865928 - 23865730
Alignment:
6 taataaatgcctttgggacatttattaaagtactaaaataagtaggtttgcatnnnnnnngttggtttttatgttctgagaaactttggactggcaggtg 105  Q
    |||| ||||||||||| ||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||| |||||||||    
23865928 taatgaatgcctttggaacatttattaaagtactaaaataagtaggtttgcataaaaaa-gttggtttttatgttctgagaaactttggaatggcaggtg 23865830  T
106 tggttgggtatggtttagtctgttcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgataaagagat 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
23865829 tggttgggtatggtttagtctgttcgccgattgctgcatatatctgtgtttatggttggttttggagtggtgaactggcagcagaatgtgatgaagagat 23865730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23359300 - 23359392
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23359300 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23359392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23364121 - 23364213
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23364121 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23364213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23694599 - 23694691
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23694599 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23694691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23713039 - 23713131
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23713039 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23713131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23731495 - 23731587
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23731495 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23731587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 23749950 - 23750042
Alignment:
106 tggttgggtatggtttagtctgt-tcgccgattgctgcatatatctgggtttatggttggttttggagtggtgaattggcagcagaatgtgat 197  Q
    ||||| |||| |||||||||| | | || |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||    
23749950 tggttcggtacggtttagtctctctggctgattgctgcatatatctgtgtttctggttggttttggagtggtgaattggcagcagaaggtgat 23750042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Original strand, 47510735 - 47510775
Alignment:
15 cctttgggacatttattaaagtactaaaataagtaggtttg 55  Q
    |||||||| |||| ||||||||||||||||||||| |||||    
47510735 cctttggggcattgattaaagtactaaaataagtaagtttg 47510775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University