View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17713_low_10 (Length: 255)
Name: NF17713_low_10
Description: NF17713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17713_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 25616351 - 25616129
Alignment:
| Q |
18 |
ccagcaggatttcttcttggtctacccctctttctcttggccacaattggggctgcaacagcttcttgctttttcttgaagcatggtttctctaagccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25616351 |
ccagcaggatttcttcttggtctacccctctttctcttggccacaattggggctgcaacgacttcttgctttttcttgaagcatggtttctctaagccat |
25616252 |
T |
 |
| Q |
118 |
tcttgccataaatttccacattgaataggttttctccgatatatgtgaaaaccaagaactcttcaagtcccactgagttgtctttcagaaacttttgcca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25616251 |
tcttgccataaatttccacattgaataggttttctccaatatatgtgaagaccaagaactcttcaagtcccactgagttgtctttcagaaacttttgcca |
25616152 |
T |
 |
| Q |
218 |
accaaagtttcgcagataaatgt |
240 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
25616151 |
accaaagtttcgcacataaatgt |
25616129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 222
Target Start/End: Complemental strand, 25610625 - 25610493
Alignment:
| Q |
90 |
ttcttgaagcatggtttctctaagccattcttgccataaatttccacattgaataggttttctccgatatatgtgaaaaccaagaactcttcaagtccca |
189 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||| |||||| | | | ||| ||| || || ||||||||||||||| ||||||||||| || |
|
|
| T |
25610625 |
ttcttgaagcatggtctctccaatccattcttgccaaaaatttgcccctggaacttgttctccccatcatatgtgaaaaccaataactcttcaagcatca |
25610526 |
T |
 |
| Q |
190 |
ctgagttgtctttcagaaacttttgccaaccaa |
222 |
Q |
| |
|
|| ||||||| ||||||| || |||||||||| |
|
|
| T |
25610525 |
ctttgttgtctatcagaaatttctgccaaccaa |
25610493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University