View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17713_low_15 (Length: 214)
Name: NF17713_low_15
Description: NF17713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17713_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 41688189 - 41688383
Alignment:
| Q |
6 |
gtcgaagaatatatgttaatacctctcttagtcgggattcgaaccaaccttgattctatagagtgcatcctctttcgctagcttttttcttcctaccctc |
105 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
41688189 |
gtcgaacaataaatgttaatacctctcttagtcgggattcgaaccaaccttgattctatagagtgcaccctttttcgctagcttttttcttcctaccctc |
41688288 |
T |
 |
| Q |
106 |
atgaccatctaggtttttaccatttaaaacaaaagtgcaagacaattagtaacaagcttacagtagaaggttagatgcattctagtagtcgttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41688289 |
atgaccatctaggtttttaccatttaaaacaaaagtgcaagacaattagacacaagcttacagtagaaggttagatgcattctagtagtcgttat |
41688383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University