View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17713_low_9 (Length: 255)
Name: NF17713_low_9
Description: NF17713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17713_low_9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 39497681 - 39497442
Alignment:
| Q |
18 |
aaagacctatgtatctgatatacaataaagttttggatcagtacttaatgtctaactactatttaattaccaatattttggagcacaaaatatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39497681 |
aaagacctatgtatctgatatacaataaagttttggatcagtacttaatgtctaactactatttaattaccaatattttggagcacaaaatatcaactga |
39497582 |
T |
|
| Q |
118 |
tcc-nnnnnnnnnngacaggaa-ttttatcatcaagtcttttgtttttgtcnnnnnnnntaaatcataaaatcttttgttatttgaaataattattgtag |
215 |
Q |
| |
|
||| |||| ||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39497581 |
tccaaaaaaaaaaagacaagaatttttatcatcaagtcttttgtttttgtcaaaaaaaataaatcataaagtcttttgttatttgaaataattattgtag |
39497482 |
T |
|
| Q |
216 |
aattcttttatttaactgaaaaatccaaccatagaggctg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39497481 |
aattcttttatttaactgaaaaatccaaccatagaggctg |
39497442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University