View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_high_11 (Length: 235)
Name: NF17714_high_11
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 219
Target Start/End: Complemental strand, 49003312 - 49003115
Alignment:
| Q |
22 |
aaagagctcattatattgaaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagtggtgcaccccgtggtagttcaccgc |
121 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49003312 |
aaagagctcattatattgcaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagtggtgcaccccgtggtagttcaccgc |
49003213 |
T |
|
| Q |
122 |
attcgggatcaagccgtgacgatcaaggtgagaatgaccaaaggccaactcaaggatttaatagggaaggtggatacaaacaatgacaatttagaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49003212 |
attcgggatcaagccgtgacgatcaaggtgaaaatgaccaaaggccaactcaaggatttaatagggaaggtggatacaaacaatgacaatttagaatt |
49003115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University