View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_high_2 (Length: 657)
Name: NF17714_high_2
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-26; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 1828558 - 1828497
Alignment:
| Q |
16 |
tcaataatgtctccctactcaacgttcagtttaaaacatattatccatgtacttcttgattt |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1828558 |
tcaataatgtctccctactcaacgttcagtttaaaacatattatccatgtacttcttgattt |
1828497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 579 - 646
Target Start/End: Original strand, 6525810 - 6525877
Alignment:
| Q |
579 |
aacatcagaggacaagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
6525810 |
aacatcagagaacaagacttcagaaattggaagcaatggtaagagctgaatcccaagcctacattctt |
6525877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 566
Target Start/End: Original strand, 6525644 - 6525719
Alignment:
| Q |
491 |
tcaatgagtttccttcatcaaaaacatttgactttcttatcttttgcagtgcactttcattgtcataaattccttg |
566 |
Q |
| |
|
||||||||||||| ||||||||| | || ||||||||||||| ||| ||||||||||||| |||||||| ||||| |
|
|
| T |
6525644 |
tcaatgagtttccatcatcaaaacccttcaactttcttatcttctgctgtgcactttcattatcataaatcccttg |
6525719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 577 - 645
Target Start/End: Complemental strand, 6462562 - 6462494
Alignment:
| Q |
577 |
tcaacatcagaggacaagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattct |
645 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||| |||||||||||||| ||| || || ||||||||| |
|
|
| T |
6462562 |
tcaacatcagagaacaatacttcagaaataggaaccaatggtaagagctgaattccaagtctacattct |
6462494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 579 - 646
Target Start/End: Complemental strand, 1842493 - 1842426
Alignment:
| Q |
579 |
aacatcagaggacaagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
||||||||||||||| | |||||||| ||| || | ||||||||||| ||||||||||| |||||||| |
|
|
| T |
1842493 |
aacatcagaggacaaaatttcagaaatagggagtagtggtaagagctgaatgccgagccaacattctt |
1842426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 580 - 646
Target Start/End: Original strand, 6496113 - 6496179
Alignment:
| Q |
580 |
acatcagaggacaagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||||||||||| || || | ||||||||||| |
|
|
| T |
6496113 |
acatcagagaacaatacttcagaaataggaagcaatggtaagagctgaactccaaccctacattctt |
6496179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 341 - 396
Target Start/End: Complemental strand, 1847222 - 1847166
Alignment:
| Q |
341 |
aaattatttaagacggct-tgcaatctggacccaaatttgagaatgaatggatgaaa |
396 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
1847222 |
aaattatttaagacggcactgcaatctagacccaaagttgagaatgaatgtatgaaa |
1847166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 592 - 646
Target Start/End: Original strand, 6464785 - 6464839
Alignment:
| Q |
592 |
aagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
6464785 |
aagaattcagaaattggaagcaatggtaagagctgaatcccaagcctacattctt |
6464839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 577 - 646
Target Start/End: Complemental strand, 6473784 - 6473715
Alignment:
| Q |
577 |
tcaacatcagaggacaagacttcagaaacaggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
|||||||| || |||| |||||||||| ||||| |||||||| ||||| ||| || ||||||||||||| |
|
|
| T |
6473784 |
tcaacatctgaaaacaaaacttcagaaataggaatcaatggtaggagctgaattccaagcctacattctt |
6473715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 646
Target Start/End: Complemental strand, 1832442 - 1832402
Alignment:
| Q |
606 |
aggaagcaatggtaagagcttaatgccgagcctacattctt |
646 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
1832442 |
aggaagaaatggtaagagctgaatgccgagccgacattctt |
1832402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 233 - 282
Target Start/End: Complemental strand, 17848814 - 17848766
Alignment:
| Q |
233 |
ttgattttttgatgttatttacaagctaaataaaaagatgtctctttttg |
282 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
17848814 |
ttgagtttttgatgttatttacaagttaaat-aaaagatgtcactttttg |
17848766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University