View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_low_10 (Length: 248)
Name: NF17714_low_10
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 1423128 - 1423347
Alignment:
| Q |
19 |
gaactaattctgaattagaatcacaaaaaacacatctgaaaaaatgtaacttagacactgaaaactgaaaattgtatactctcttccactagacacattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1423128 |
gaactaattctgaattagaatcacaaaaaacacatctgaaaaaatgtaacttagacactgaaaactgaaaattgtacactctcttccactagacacattt |
1423227 |
T |
|
| Q |
119 |
atgccactctcttcactattttgttatattcgtttgcactgctttacctatacagttattaattttatctctatatttcttttcagggatggaggctctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1423228 |
atgccactctcttcactattttgttatattcgtttgcactgctttacctatacagttattaattttatctctatatttcttttcagggatggaggctctt |
1423327 |
T |
|
| Q |
219 |
gattctgtcgatgacctatg |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1423328 |
gattctgtcgatgacctatg |
1423347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 116 - 235
Target Start/End: Complemental strand, 17602918 - 17602802
Alignment:
| Q |
116 |
tttatgccactctcttcactattttgttatattcgtttgcactgctttacctatacagttattaattttatctctatatttcttttcagggatggaggct |
215 |
Q |
| |
|
||||||||| || ||||||||||||| ||||| ||||| || ||||||||||||| ||||| |||||||| | ||||| ||||||| ||||||||| |
|
|
| T |
17602918 |
tttatgccatgcttttcactattttgtaatatttgtttgtacggctttacctatactgttat---ttttatctgtgtatttgttttcagtgatggaggcc |
17602822 |
T |
|
| Q |
216 |
cttgattctgtcgatgacct |
235 |
Q |
| |
|
|||| |||||| || ||||| |
|
|
| T |
17602821 |
cttggttctgtggacgacct |
17602802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University