View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_low_12 (Length: 237)
Name: NF17714_low_12
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 88 - 162
Target Start/End: Original strand, 53258148 - 53258222
Alignment:
| Q |
88 |
tagtaatttaattgagttttaccctaagatctaagtctccttcagtggaaggcattgttgtctttgataaaagag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53258148 |
tagtaatttaattgagttttaccctaagatctaagtctccttcagtggaaggcattgttgtctttgataaaagag |
53258222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Original strand, 53258248 - 53258277
Alignment:
| Q |
188 |
gttttagatctatctaatgctaatgcttta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53258248 |
gttttagatctatctaatgctaatgcttta |
53258277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University