View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17714_low_13 (Length: 235)

Name: NF17714_low_13
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17714_low_13
NF17714_low_13
[»] chr7 (1 HSPs)
chr7 (22-219)||(49003115-49003312)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 219
Target Start/End: Complemental strand, 49003312 - 49003115
Alignment:
22 aaagagctcattatattgaaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagtggtgcaccccgtggtagttcaccgc 121  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49003312 aaagagctcattatattgcaaaggagtaaaaatgggtaatgcttgctttggaaagaagatgagcaacaagggagtggtgcaccccgtggtagttcaccgc 49003213  T
122 attcgggatcaagccgtgacgatcaaggtgagaatgaccaaaggccaactcaaggatttaatagggaaggtggatacaaacaatgacaatttagaatt 219  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49003212 attcgggatcaagccgtgacgatcaaggtgaaaatgaccaaaggccaactcaaggatttaatagggaaggtggatacaaacaatgacaatttagaatt 49003115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University