View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_low_18 (Length: 217)
Name: NF17714_low_18
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_low_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 8813934 - 8813729
Alignment:
| Q |
12 |
gagatgaatgagagagaagttgttgaaatcaaagacgggagaaggagaaggtgaggaatgtcggcggagtgggaggtagtgtttgatttttccagtggag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8813934 |
gagatgaatgagagagaagttgttgaaatcaaagacgggagaaggagaaggtgaggaatgtcggcggaatgggaggtagtgtttgatttttccagtggag |
8813835 |
T |
 |
| Q |
112 |
ttttgtgttattttagtcaaccaaggatgaattagggattgtggtggtgatttgatgaggaagaaaccgtgtttggagagatcagagaatggagttttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8813834 |
ttttgtgttattttagtcaaccaaggatgaattagggattgtggtggtgatttgatgatgaagaaaccgtgtttggagagatcagagaatggagttttgt |
8813735 |
T |
 |
| Q |
212 |
ttgtga |
217 |
Q |
| |
|
|||||| |
|
|
| T |
8813734 |
ttgtga |
8813729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 250811 - 250775
Alignment:
| Q |
155 |
gtggtgatttgatgaggaagaaaccgtgtttggagag |
191 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
250811 |
gtggtggtttgatgaggaagaaaccgtgtttagagag |
250775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University