View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17714_low_5 (Length: 499)
Name: NF17714_low_5
Description: NF17714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17714_low_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 482; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 482; E-Value: 0
Query Start/End: Original strand, 18 - 499
Target Start/End: Original strand, 24211243 - 24211724
Alignment:
| Q |
18 |
gattcgactttggaaaattgcctgacgtgacttctttgatccctgttgggagcaaaaatggttctttgccaggtttgtcatttggaagtcctacaaggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211243 |
gattcgactttggaaaattgcctgacgtgacttctttgatccctgttgggagcaaaaatggttctttgccaggtttgtcatttggaagtcctacaaggaa |
24211342 |
T |
 |
| Q |
118 |
gaaggatccttcgacggtttttgttgccggtgctactggtcaagctggtatccgcattgcacagactttgcttagagaagggtttagtgttagagctggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211343 |
gaaggatccttcgacggtttttgttgccggtgctactggtcaagctggtatccgcattgcacagactttgcttagagaagggtttagtgttagagctggt |
24211442 |
T |
 |
| Q |
218 |
gttcctgaacttggttctgctcaggaattggctcgtcttgcttctcaatataaggtaatttaatttaacttcttaatcaaccattaatttggattattaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211443 |
gttcctgaacttggttctgctcaggaattggctcgtcttgcttctcaatataaggtaatttaatttaacttcttaatcaaccattaatttggattattaa |
24211542 |
T |
 |
| Q |
318 |
tgatcaagattcaaaaagatgttccatactatctagtatcaatggcgtgtgtccggtgtctgacatgtgtttgacacgatatctgatatctcgacacatg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211543 |
tgatcaagattcaaaaagatgttccatactatctagtatcaatggcgtgtgtccggtgtctgacatgtgtttgacacgatatctgatatctcgacacatg |
24211642 |
T |
 |
| Q |
418 |
tagttagaatttaatcactgacattttctttggttgcatgtttgtgtctagtatcgtatctggccttcatgtttatgtcatt |
499 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211643 |
tagttagaatttaatcactgacattttctttggttgcatgtttgtgtctagtatcgtatctggccttcatgtttatgtcatt |
24211724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University