View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17715_low_13 (Length: 229)
Name: NF17715_low_13
Description: NF17715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17715_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 53956499 - 53956293
Alignment:
| Q |
1 |
tatggaaaatttatgtgtctgtctacttttatttaggtgaataagattatgaaactaaaaacatccagaaataccttaaagaattaaagacagtaccgtt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53956499 |
tatggaaaatttatgt--ctgtctacttttatttaggtgaataagattatgaaactaaaaacatccagaaataccataaagaattaaagacagtaccgtt |
53956402 |
T |
 |
| Q |
101 |
agattaagcttaacttaatattgtgatcaaatattgctttactggtgtaattaaattttaatttttctgacctttggagcaatgaatgattcttactcaa |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53956401 |
aaattaagcttaacttaatattgtgatcaaatattgctttactggtgtaattaaattttaatttttctgacctttggagcaatgaatgattcttactcaa |
53956302 |
T |
 |
| Q |
201 |
actacaggt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
53956301 |
actacaggt |
53956293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University