View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17715_low_15 (Length: 209)
Name: NF17715_low_15
Description: NF17715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17715_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 80 - 194
Target Start/End: Original strand, 36942413 - 36942527
Alignment:
| Q |
80 |
tgacccatgagtgtagctttgataatggagagagggaggttttcaatgaggatatgtggttgagaggttgttgtttgtgatggcgatcgctgggcattgt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942413 |
tgacccatgagtgtagctttgataatggagagagggatgttttcaatgaggatatgtggttgagaggttgttgtttgtgatggcgatcgctgggcattgt |
36942512 |
T |
|
| Q |
180 |
ggtgtttaatctgtg |
194 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36942513 |
ggtgtttaatctgtg |
36942527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 36936326 - 36936392
Alignment:
| Q |
18 |
atttctacccggatttagactggagaagtatatctttcctaggagttgggcgtttgggattctgacc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36936326 |
atttctacccggatttagactggagaagtatatctttcctaggagttgggcatttgggattctgacc |
36936392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University