View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_68 (Length: 286)
Name: NF17716_high_68
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 16 - 153
Target Start/End: Original strand, 7879421 - 7879558
Alignment:
| Q |
16 |
atcgactgtgattgaaccagaaatcataagaaaactaaagcacagaaggaattgtctggaaacaaaacctttatcttgcaatctcgtcatgatccagcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7879421 |
atcgactgtgattgaaccagaaatcacaagaaaactaaagcacggaaggaattgtttggaatcaaaacctttatcttgcaatctcgtcatgatccagcag |
7879520 |
T |
 |
| Q |
116 |
caattaactctcttcatgcgctcttcggttgatcgatt |
153 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7879521 |
cgattaactctcttcatgcgctcttcggttgatggatt |
7879558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 8588768 - 8588655
Alignment:
| Q |
16 |
atcgactgtgattgaaccagaaatcataagaaaactaaagcacagaaggaattgtctggaaacaaaacctttatcttgcaatctcgtcatgatccagcag |
115 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
8588768 |
atcgactgtgatttaaccagaaaccgcaagaaaactaaagcacagaagaaattgtttggaaacaaaacctttatcttgcaatttcgtcatgatccagtaa |
8588669 |
T |
 |
| Q |
116 |
caattaactctctt |
129 |
Q |
| |
|
| |||| ||||||| |
|
|
| T |
8588668 |
cgattacctctctt |
8588655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 214 - 265
Target Start/End: Original strand, 7880084 - 7880135
Alignment:
| Q |
214 |
gttgcctcttggttctatttctgtgtgcatgagtatctttatgcatgatcat |
265 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7880084 |
gttgcctcttggttctgtttctgtgtgcatgagtctctttatgcatgatcat |
7880135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University