View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_75 (Length: 250)
Name: NF17716_high_75
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 8375704 - 8375937
Alignment:
| Q |
1 |
ctgcaaaagtacttgcaaccggcgtctatattgcttgcaactcaggactgttttgtgcgaccgggacattacgggtagcaacaagtgattcaacaatatg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8375704 |
ctgcaaaagtacttgcaaccggtgtctatattgcttgcaactcgggactgttttgtgcgaccgtgacattaggggtagcaacaagtgattcaacaatatg |
8375803 |
T |
 |
| Q |
101 |
ttcttcttttgttgcagttgctgaatcaatagcttcaaatgcattagaagaaccaacaccagaagaatttcctttaataggcaccaaatctagcttacta |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8375804 |
ctcttcttttgttgcagttgccgaatcaatagcttcaaatgcattagaagaaccaacaccaaaagaattttctttaataggcaccaaatctagcttacta |
8375903 |
T |
 |
| Q |
201 |
gttggtatttgcttcttgccctttatagcatttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8375904 |
gttggtatttgcttcttgccctttatagcatttt |
8375937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Original strand, 18145631 - 18145663
Alignment:
| Q |
206 |
tatttgcttcttgccctttatagcattttcctt |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
18145631 |
tatttgcttcttgccctttataacattttcctt |
18145663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University