View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_78 (Length: 244)
Name: NF17716_high_78
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 109 - 225
Target Start/End: Original strand, 40352190 - 40352306
Alignment:
| Q |
109 |
gctgatatctcttcactacaaagttaaaagcgggtaactgttgaaaaggtaaaagctcattattacccaataccaatatcagtttattcaattattggtc |
208 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || ||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
40352190 |
gctgatatctcttcactacaaagtcaaaagtggataactattgaaaaggtaaaaactcattattatccaataccaatatcagtttattcaattattgttc |
40352289 |
T |
 |
| Q |
209 |
cacaaacctacctgctt |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40352290 |
cacaaacctacctgctt |
40352306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University