View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_82 (Length: 239)
Name: NF17716_high_82
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_82 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 8375689 - 8375461
Alignment:
| Q |
1 |
tccttcagttttgccgtacaaaatgtgtctgatgtaattcctcatggggctctcacttagtcggctagtcctatgttggaattggttccccaagtgatat |
100 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8375689 |
tcctttagttttgccctacaaaatgtgtctgatgtaattcctcatggggctctcccttagtcgactagtcctatgttggaattggttccctaagtgatat |
8375590 |
T |
|
| Q |
101 |
tccccccgtgaacaacaccattgtcatgcaaggggtggggctgaatgttgttccgacagacattgctttaattccaactt---atgtggcacctattgat |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| || || ||||||||||| |
|
|
| T |
8375589 |
tccccccgtgaataacaccattgtcatgcaaggggtggagctgaatgttgttccgacagacattgctttaattcgaacttctgatatgacacctattgat |
8375490 |
T |
|
| Q |
198 |
ggaaacattgtcatacaaggagagagttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8375489 |
ggaaacattgtcatacaaggagagagttg |
8375461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 95
Target Start/End: Complemental strand, 18145428 - 18145337
Alignment:
| Q |
4 |
ttcagttttgccgtacaaaatgtgtctgatgtaattcctcatggggctctcacttagtcggctagtcctatgttggaattggttccccaagt |
95 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||||| || | | || || || |||||||| ||||||||||| |||||||||| |
|
|
| T |
18145428 |
ttcagttttgaactacaagatgtgtctgatgaaattcctcatgtggatttgcctgagacgactagtcctgtgttggaattgattccccaagt |
18145337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University