View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_90 (Length: 226)
Name: NF17716_high_90
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 27429140 - 27429367
Alignment:
| Q |
1 |
caaataacactttcaaacatttacaacccaaaaag--------agatgctttattttctctctttatatataaaggtaagtaatcattattcatgaggat |
92 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27429140 |
caaataacactttcaaacattgacaacccaaaaagttaaatagagatgctttattttctctctttatatataaaggtaagtaatcattattcatgaggat |
27429239 |
T |
 |
| Q |
93 |
caggagtgtgtggccattgtattttgaatgctgtaaataggatatatctcacaacattcacaaattaactatctccatcaactttttgcttattgcacta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27429240 |
caggagtgtgtggccattgtattttgaatgctgtaaataggatatatctcacaacattcacaaattaactatctccatcaactttttgcttattggacta |
27429339 |
T |
 |
| Q |
193 |
aaccccacattcccactcaccccaaaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27429340 |
aaccccacattcccactcaccccaaaac |
27429367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University