View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_high_96 (Length: 205)
Name: NF17716_high_96
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_high_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 19 - 153
Target Start/End: Complemental strand, 48372855 - 48372721
Alignment:
| Q |
19 |
aatatggtactgaatgggattggggagcaatttcatttcatgcatgaaaaccaacattatttcttaaccctgtatttgactctcatattaaatttttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48372855 |
aatatggtactgaatgggattggggagcaatttcatttcatgtatgaaaaccaacattattttttaaccctgtatttgactctcatattaaatttttcat |
48372756 |
T |
 |
| Q |
119 |
ttgaatnnnnnnnngaattaaatgaataagggaat |
153 |
Q |
| |
|
|||||| |||||||||||||||| |||| |
|
|
| T |
48372755 |
ttgaatgaaaaaaagaattaaatgaataagtgaat |
48372721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University