View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_106 (Length: 213)
Name: NF17716_low_106
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 6612552 - 6612357
Alignment:
| Q |
1 |
tattgcctctgagatggaaggaaaaactgaggaggaagttgaaagatatgcaaaggtcttcaaagaaagatacaaggaattaaatggtatgttacaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6612552 |
tattgcctctgagatggaaggaaaaactgaggaggaagttgaaagatatgcaaaggtcttcaaagaaagatacaaggaattaaatggtatgctacaacca |
6612453 |
T |
|
| Q |
101 |
agttgttacaaccaatttgagtgtgactgtgaaacaggcttttgttgtatatttgaacatggaatcaaaacactttgctaaatccagatcagtgtg |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6612452 |
atttgttacaaccaatttgagtgtgactgtgaaacaggcttttgttgtatatttgaacatggaatcaaaacactttgctaaatccagatcagtgtg |
6612357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 49258556 - 49258644
Alignment:
| Q |
1 |
tattgcctctgagatggaaggaaaaactgaggaggaagttgaaagatatgcaaaggtcttcaaagaaagatacaaggaattaaatggta |
89 |
Q |
| |
|
|||||| ||||||||||||||||| || || || |||||||||||||||||| | || |||| ||| ||||||||||||| ||||||| |
|
|
| T |
49258556 |
tattgcttctgagatggaaggaaagacggaagaagaagttgaaagatatgcagaagttttcagagagcgatacaaggaattgaatggta |
49258644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University