View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_59 (Length: 329)
Name: NF17716_low_59
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 20 - 318
Target Start/End: Original strand, 42015705 - 42016003
Alignment:
| Q |
20 |
ctgttagtgtttaattactctgtttatccaaacggttgtcttagccattacaatttgattttgacgatgaagcacatatttgtgtacactgtaacagttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42015705 |
ctgttagtgtttaattactctgtttatccaaacggttgtcttcgccattacaatttgattttgacgatgaagcacatatttgtgtacactgtaacagttg |
42015804 |
T |
|
| Q |
120 |
gtgagagtggtcctttagttgagagatggaagtggtcgaggccaaatgcacgtgtttatacattgttgattcagggtttggctgcatctttgagggtttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42015805 |
gtgagagtggtcctttagttgagagatggaagtggtcgaggccaaatgcacgtgtttatacattgttgattcagggtttggctgcatctttgagggtttc |
42015904 |
T |
|
| Q |
220 |
ggatgctcttagtgtggttaaatatatatgtgaggtgggcgtctctccttctgaggaggtagggttaaataattttcttgtttctcttgagttcttcat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42015905 |
ggatgctcttagtgtggttaaatatatatgtgaggtgggcgtctctccttctgaggaggtagggttaaataattttcttgtttctcttgagttcttcat |
42016003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University