View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_60 (Length: 324)
Name: NF17716_low_60
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 36084171 - 36083898
Alignment:
| Q |
17 |
aaacaaacactgaatttgagctagattgtttataatgttccattgtttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084171 |
aaacaaacactgaatttgagctagattgtttataatgttccattgtttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggt |
36084072 |
T |
 |
| Q |
117 |
cgcggccacgcagtaatctttgatattgtagaaaatcacggataaatacaacttgtgtttccgcaatagcgatcacaatttgatgtccgtgacaatataa |
216 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
36084071 |
cgcggccacgcattaatatttgatattgtagaaaattgcggataaatacaacttgtgtttccgcgatagcgatcacaatttgatgttggtgacaatataa |
36083972 |
T |
 |
| Q |
217 |
cgttgaaaacgctgctatattttccgttgcagaccgttttttaaaaccttgaccaagatttaaggattagcttt |
290 |
Q |
| |
|
|||||||| | | ||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36083971 |
cgttgaaatcacggctatatttgccgttgcagaccattttttaaaaccttgaccaagatttaaggactagcttt |
36083898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University