View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_63 (Length: 306)
Name: NF17716_low_63
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 136 - 296
Target Start/End: Original strand, 41787380 - 41787540
Alignment:
| Q |
136 |
atttgcagatattgttttgaaccatagggaaggtatgttttcacttgagaatcaccagtcaacaaaagcagcaacagaagtccagaatgatatgattctt |
235 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787380 |
atttgcagatcttgttttgaaccatagggaaggtatgttttcacttgagaatcaccagtcaacaaaagcagcaacagaagtccagaatgatatgattctt |
41787479 |
T |
 |
| Q |
236 |
cctcaagaatggacatactgaagttactgtagagccacatgcatttgcaactagtcctatg |
296 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787480 |
cctcaagaatggacatattgaagttactgtagagccacatgcatttgcaactagtcctatg |
41787540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 41787240 - 41787356
Alignment:
| Q |
19 |
actatcaactagcaatttgtcgccaactagttctatagtattgaactgacagttattgattatgaatataaaactatctaatttgattttcatctatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787240 |
actatcaactagcaatttgtcgccaactagttctatagtattgaactgacagttattgattatgaatataaaactatctaatttgattttcatctatttt |
41787339 |
T |
 |
| Q |
119 |
ttgtgaatcaatttgct |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41787340 |
ttgtgaatcaatttgct |
41787356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University