View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17716_low_85 (Length: 249)

Name: NF17716_low_85
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17716_low_85
NF17716_low_85
[»] chr5 (1 HSPs)
chr5 (17-249)||(41584838-41585070)


Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 41585070 - 41584838
Alignment:
17 tgaaccagtgaccataaattagagatgagaaccagattgtatgaaaaacagatgatcatattaaagcaaaatggaaggtagcgagcgagacttccgggat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
41585070 tgaaccagtgaccataaattagagatgagaaccagattgtatgaaaaacagatgatcatattaaagcaaaatggaaggtagcgagcaagacttccgggat 41584971  T
117 cttttgggagctctaatagcagtttgttattatgcatttcaaagaataatccgagatactcaattgaagaaaccataaattaattatgatgctgaaaatc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41584970 cttttgggagctctaatagcagtttgttattatgcatttcaaagaataatccgagatactcaattgaagaaaccataaattaattatgatgctgaaaatc 41584871  T
217 aattaaaaaatgacgaataagaaagcacaataa 249  Q
    |||||||||||||||||||||||||| ||||||    
41584870 aattaaaaaatgacgaataagaaagctcaataa 41584838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University