View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_88 (Length: 242)
Name: NF17716_low_88
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 16 - 176
Target Start/End: Complemental strand, 47106876 - 47106717
Alignment:
| Q |
16 |
atatcaacacgttcggtttacggtattgttagagagtagtaacatgtattgtttgctacacatcaatgaatgacggataaattatggggataatataagc |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47106876 |
atatcaacacgttcagtttacggtattgttagagagtagtaacatgtattgtttgctacacatcaatgaatgacggataaattat-gggataatataagc |
47106778 |
T |
|
| Q |
116 |
aatgatgacaatgggtactcaatagacactctagtatagttcccctttccatactcactat |
176 |
Q |
| |
|
| |||||||||||| ||||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
47106777 |
agtgatgacaatggatactcaatagacactttactatagttccccttttcatactcactat |
47106717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University