View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_89 (Length: 242)
Name: NF17716_low_89
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_89 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 118 - 226
Target Start/End: Original strand, 8767905 - 8768013
Alignment:
| Q |
118 |
aagttgtaatagttcaccgttataccgttttgaatagatctattagatacacccttaaatattaggtttacacacggatcatttaaccatcttatggagt |
217 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8767905 |
aagttttaatagtccaccgttataccgttttgaataggtctattagatacacccttaaatattaggtatacacacggatcatttaaccatcttatggagt |
8768004 |
T |
|
| Q |
218 |
gaaaaacct |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
8768005 |
gaaaaacct |
8768013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 8767790 - 8767822
Alignment:
| Q |
6 |
tatactaaaatatgcatctaaccctaaagtttg |
38 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
8767790 |
tatactaaaatatgcatataaccctaaagtttg |
8767822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University