View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17716_low_96 (Length: 236)
Name: NF17716_low_96
Description: NF17716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17716_low_96 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 46753520 - 46753755
Alignment:
| Q |
1 |
tcattccacaatatcaataattttgtttgactaataagatactcaaggcacaattagtgaaagaataaagaggtttggtgatggccatggtgggactatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46753520 |
tcattccacaatatcaataattttgtttgactaataagatactcaaggcacaattagtgaaagaataaagaggtttggtgatggccatggtgggactatg |
46753619 |
T |
 |
| Q |
101 |
gcttcaacgtcccttgaagagctttctcaaactttcttttgaattttttcaatgaattaatactttataattatagatacgatctttaaagattgcagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46753620 |
gcttcaacgtcccttgaagagctttctcaaactttcttttgaagtttttcaatgaattaatactttataattatagatacgatctttaaagattgcagaa |
46753719 |
T |
 |
| Q |
201 |
agaaatgagtaaattttaaatcggttagttatgata |
236 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46753720 |
agaaacgagtaaattttaaatcggttagttatgata |
46753755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University