View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17717_high_5 (Length: 269)
Name: NF17717_high_5
Description: NF17717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17717_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 189 - 250
Target Start/End: Original strand, 44066047 - 44066108
Alignment:
| Q |
189 |
ggataaaatctgcctctttgctgtttcttgttttttactcaacctctttgttgtgtccatag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44066047 |
ggataaaatctgcctctttgctgtttcttgttttttactcaatctctttgttgtgtccatag |
44066108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 66
Target Start/End: Original strand, 44065885 - 44065917
Alignment:
| Q |
34 |
tctctcgttgagttgagtagttagttaatgaaa |
66 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
44065885 |
tctctcgttgagttgagtagttaattaatgaaa |
44065917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University