View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17717_low_3 (Length: 414)
Name: NF17717_low_3
Description: NF17717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17717_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 13 - 323
Target Start/End: Complemental strand, 28757034 - 28756730
Alignment:
| Q |
13 |
aatataatcctctcatcaaactttacgttttctgccaaatagatcaacaaaccattgtttctttttattttgcactattaatttatcatattctttttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
28757034 |
aatataatcctctcatcaaactttacgttttctgccaaatagatcaacaaaccattgttt--ttttattttgcacttttaattcatcatattctttttta |
28756937 |
T |
|
| Q |
113 |
gatcttgaacaccacataggctatatttcgaaaaaccaccaccatagaaggactaactatcatctcctataccaaagacacagnnnnnnnnnnnnnnnnn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
28756936 |
gatcttgaacaccacataggctatatttcgaaaaaccaccaccatagaaggactaaccatcatctcctatgccaaagacacag----tttttcttttttt |
28756841 |
T |
|
| Q |
213 |
nnnatgatcgcaatattttcccagtaaccaccacactggaatttgtgccgccttgcccgaattagtggtgttggaatatatgcctctgttatggaatcat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28756840 |
tttatgatcgcaatattttcccagtaaccaccgcactggaatttgtgccgccttgccggaattagtggtgttggaatatatgcctctgttatggaatcat |
28756741 |
T |
|
| Q |
313 |
gcggtttctac |
323 |
Q |
| |
|
||||||||||| |
|
|
| T |
28756740 |
gcggtttctac |
28756730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University