View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17717_low_8 (Length: 318)
Name: NF17717_low_8
Description: NF17717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17717_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 218 - 303
Target Start/End: Complemental strand, 7360684 - 7360599
Alignment:
| Q |
218 |
tagaacgcccaatttcatggatttccagtgttatgctaatatttgctattttcataagcaagaggctttaagtttgagatactaaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7360684 |
tagaacgcccaatttcatggatttccagtgttatgctaatatttgctattttcataagcaagaggctttaagtttgagatactaaa |
7360599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 1004449 - 1004405
Alignment:
| Q |
10 |
aagaatattgttaggtagaagatgaagattctgaagaactagatt |
54 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004449 |
aagagtattgttaggtagaagatgaagattctgaagaactagatt |
1004405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 59 - 101
Target Start/End: Complemental strand, 986339 - 986297
Alignment:
| Q |
59 |
acagaacaatttatgaagataaagaaaaaagtattatattgta |
101 |
Q |
| |
|
|||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
986339 |
acagaacaatttgtgaagttaaagaaacaagtattatattgta |
986297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University