View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17718_high_11 (Length: 346)
Name: NF17718_high_11
Description: NF17718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17718_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 34669649 - 34669988
Alignment:
| Q |
1 |
atttcaagacaaacattcttctcaatctgatgttgtgattgaagttgatttaccatcaagttcaaacacactactacaaggaatgtctaataccttagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
34669649 |
atttcaagacaaacattcttctcaatctgatgttgtgattgaagttgatttaccatcaagttcaaaaacactactacaaggaatctctaataccttagag |
34669748 |
T |
|
| Q |
101 |
ctggtcgatatgtccgaagaatttttgaagctcagttccatggatgatctttgccaatggtttgctccttcagcagaggatactagtatctgcagaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
34669749 |
ctggtcgatatgtccgaagaatttttgaagttcagttccatggatgatctttgccaatggtttgctccttcatcagaggatactagtatctgcagaaaaa |
34669848 |
T |
|
| Q |
201 |
tgattcaattggataataccctttctgaatcaatagagtttaatcctgattgccctgatctaggcctagctgagaaagaaacatctgtagtaatacataa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669849 |
tgattcaattggataataccctttctgaatcaatagagtttaatcctgattgcactgatctaggactagctgagaaagaaacatctgtagtaatacataa |
34669948 |
T |
|
| Q |
301 |
ttctgagaatggtttcttggatagcacggaatttgatctg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669949 |
ttctgagaatggtttcttggatagcacggaatttgatctg |
34669988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University