View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17718_high_5 (Length: 388)
Name: NF17718_high_5
Description: NF17718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17718_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 9e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 31 - 222
Target Start/End: Original strand, 43855293 - 43855487
Alignment:
| Q |
31 |
gagatccaacattgtgaattatgagtttgttacgaatcattttacttatgttttgagcgaaagaattcagattaaggttttggtccttacaacctgaag- |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
43855293 |
gagatccaacattgtgaattatgagtttgctacgaatcattt-actcatgttttgagagaaacaattcagattaaggttttggtcctgtcaacctgaaga |
43855391 |
T |
|
| Q |
130 |
---gtggttgagaaaatgattaagttttgatctgttcttactttgatccttttgctgttgtggaaaataaaatgggttgaagaatattcaactcat |
222 |
Q |
| |
|
||| ||||||||||||| |||||| ||| ||||||||||| ||||||||||| |||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
43855392 |
aatatgggtgagaaaatgattgagtttttatccattcttactttggtccttttgctgctgtggacaataaaattggttgaagaattgtcaactcat |
43855487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 272 - 371
Target Start/End: Original strand, 43855490 - 43855589
Alignment:
| Q |
272 |
gacactgtgagtgagtttcaagaactaaagtggttctttacttgtttttcatcctataaaacattttgggatctatctaaattgatacgcaagttccaat |
371 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
43855490 |
gacactgtgagtgactttctagaactaaagtggttctttacttgtttttcatcctataaaacattatcggatctatctaaattgatacgcaagttccaat |
43855589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University