View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17718_low_17 (Length: 268)
Name: NF17718_low_17
Description: NF17718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17718_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 41969450 - 41969222
Alignment:
| Q |
19 |
ctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaaatgctataaatacgtaactcaacgtttcttcataatcacaattcacata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41969450 |
ctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaaatgctataaatacgtaactcaacgtttcttcataatcacaattcacata |
41969351 |
T |
|
| Q |
119 |
acttttttgcgtttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttgtgttgtttcttcttgtacagagcaaggtaa |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41969350 |
acttttttgcttttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttg---tgtttcttcttgtacagagcaaggtaa |
41969254 |
T |
|
| Q |
219 |
atcgacatattattatgctatgcatatttatc |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
41969253 |
atcgacatattattatgctatgaatatttatc |
41969222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 1236513 - 1236305
Alignment:
| Q |
19 |
ctttcatcactaaaatagagccaccctttcatagattcagttcaagtagaa-atgctataaatacgtaactcaac---gtttcttcataatcacaattca |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1236513 |
ctttcatcactaaaatagagcca-cctttcatagattcagttcatgtagaatttgctataaatacgtaactcaacaattcttcttcataatcacaattca |
1236415 |
T |
|
| Q |
115 |
cataacttttttgcgtttcgtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttgtgttgtttcttcttgtacagagcaag |
214 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
1236414 |
cataacttttttgcttttagtaaagctttgagtaatggcaaaaaattataacatcaatatgctcttcttagttg---tgtttcttcttgtacaaagcaag |
1236318 |
T |
|
| Q |
215 |
gtaaatcgacata |
227 |
Q |
| |
|
||| || |||||| |
|
|
| T |
1236317 |
gtatattgacata |
1236305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University